addgene 124811 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
addgene 124811
Addgene 124811, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/addgene+124811/PX459-gR2A_Hinge+(Plasmid+%23124811)/pmc12270900-245-55-55
Average 93 stars, based on 40 article reviews
Addgene 124811, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/addgene+124811/PX459-gR2A_Hinge+(Plasmid+%23124811)/pmc12270900-245-55-55
Average 93 stars, based on 40 article reviews
addgene 124811 - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Cloning:Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads. Article Snippet: .. Cloning of CRISPR-Cas9 and donor constructs The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described27: for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, CRISPR:Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads. Article Snippet: .. Cloning of CRISPR-Cas9 and donor constructs The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described27: for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, Construct:Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads. Article Snippet: .. Cloning of CRISPR-Cas9 and donor constructs The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described27: for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads Article Snippet: .. The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described : for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, Genomic Sequencing:Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads. Article Snippet: .. Cloning of CRISPR-Cas9 and donor constructs The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described27: for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, Article Title: Site-directed multivalent conjugation of antibodies to ubiquitinated payloads Article Snippet: .. The genomic sequences of the rIgG2a and mIgG2a heavy chain loci were identified via the Ensembl rate genome build Rnor_6.0 and used for the design of the different HDR donor templates. guide RNA (gRNA) for the rIgG2a constructs were previously described : for Hinge HDR constructs, gRNA-H, GACTTACCTGTACATCCACA, Addgene 124808; for isotype switch, gRNA-ISO, TGTAGACAGCCACAGACTTG, |